HUGE

Gene/Protein Characteristic Table for KIAA1799

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07606
Accession No. :	AB058702
Description :	Novel protein.
HUGO Gene Name :	EF-hand calcium binding domain 7 (EFCAB7)
Clone Name :	fj20761 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3973 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 610 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH15814	0	99.5	EF-hand calcium...	Homo sapiens
XP_513455	0	99.0	hypothetical pr...	Pan troglodytes
XP_001499786	0	88.9	similar to EF-h...	Equus caballus
BAE24969	1.2e-206	83.2	unnamed protein...	Mus musculus
Q8VDY4	3.3e-206	83.1	EF-hand calcium...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 107 170 PD000012 Calcium-binding EF-hand

HMMPfam IPR002048 110 138 PF00036 Calcium-binding EF-hand

IPR002048 146 174 PF00036 Calcium-binding EF-hand

IPR002048 411 432 PF00036 Calcium-binding EF-hand

HMMSmart IPR002048 110 138 SM00054 Calcium-binding EF-hand

IPR002048 146 174 SM00054 Calcium-binding EF-hand

IPR002048 411 439 SM00054 Calcium-binding EF-hand

ProfileScan IPR002048 106 141 PS50222 Calcium-binding EF-hand

IPR002048 142 177 PS50222 Calcium-binding EF-hand

IPR002048 407 442 PS50222 Calcium-binding EF-hand

ScanRegExp IPR002048 420 432 PS00018 Calcium-binding EF-hand

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	107	170	PD000012	Calcium-binding EF-hand
HMMPfam	IPR002048	110	138	PF00036	Calcium-binding EF-hand
IPR002048	146	174	PF00036	Calcium-binding EF-hand
IPR002048	411	432	PF00036	Calcium-binding EF-hand
HMMSmart	IPR002048	110	138	SM00054	Calcium-binding EF-hand
IPR002048	146	174	SM00054	Calcium-binding EF-hand
IPR002048	411	439	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	106	141	PS50222	Calcium-binding EF-hand
IPR002048	142	177	PS50222	Calcium-binding EF-hand
IPR002048	407	442	PS50222	Calcium-binding EF-hand
ScanRegExp	IPR002048	420	432	PS00018	Calcium-binding EF-hand

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGCTAATGATCGAGAAGGAG

Primer_r
: ATTACTTTGGCATCACCGTTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Primer_f	: AAGCTAATGATCGAGAAGGAG
Primer_r	: ATTACTTTGGCATCACCGTTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1799

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information