HUGE

Gene/Protein Characteristic Table for KIAA1800

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04989
Accession No. :	AB058703
Description :	FAST kinase domain-containing protein 1.
HUGO Gene Name :
Clone Name :	fj21226 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4156 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1945 bp

Genome contig ID gi89161199r_169992636
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
TCCTTTGGATATAAATCATTAAAAATTTAGTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATACTTGTGGTACATGGAAATCTTGATTGAATAACCCTGGTATACTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 170092636 170133962 13 99.3 Internal No-hit

Features of the protein sequence	Description

Length: 736 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q53R41	95.8	FAST kinase dom...	Homo sapiens
EAX11271	95.7	hypothetical pr...	Homo sapiens
XP_515885	95.2	hypothetical pr...	Pan troglodytes
BAB85043	95.5	unnamed protein...	Homo sapiens
EAX11272	95.5	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058695	5.6e-08	20.6	KIAA1792

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010622 432 502 PF06743 FAST kinase leucine-rich

IPR013579 516 602 PF08368 FAST kinase-like protein

IPR013584 668 727 PF08373 RAP domain

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010622	432	502	PF06743	FAST kinase leucine-rich
IPR013579	516	602	PF08368	FAST kinase-like protein
IPR013584	668	727	PF08373	RAP domain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGTAGTTTTGCCACATCTG

Primer_r
: AGAAGTGACTCAGGAAACGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1945 bp
Genome contig ID	gi89161199r_169992636
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- TCCTTTGGATATAAATCATTAAAAATTTAGTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATATACTTGTGGTACATGGAAATCTTGATTGAATAACCCTGGTATACTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	170092636	170133962	13	99.3	Internal No-hit

Primer_f	: TGAGTAGTTTTGCCACATCTG
Primer_r	: AGAAGTGACTCAGGAAACGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1800

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information