HUGE

Gene/Protein Characteristic Table for KIAA1802

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00922
Accession No. :	AB058705
Description :
HUGO Gene Name :
Clone Name :	fj21631 [Vector Info]
Flexi ORF Clone :	pF1KSDA1802
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3555 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1040 bp

Genome contig ID gi51511729f_114007344
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
GTATCAACCAAATTAAAAAGAAAGGTTTTCATGTC
Flanking genome sequence
(103556 - 103605)
----+----*----+----*----+----*----+----*----+----*
AGCAACATCTTCATGTGTGTTTTCTTTTGTGTAGTTTTCATTGTATGATA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 f 114107344 114110898 1 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001089737	1e-190	97.7	similar to F35A...	Macaca mulatta
BAC11273	5.9e-176	99.6	unnamed protein...	Homo sapiens
EDM08915	1e-119	77.1	rCG43039, isofo...	Rattus norvegicus
Q8K327	1.2e-119	76.0	Zinc finger pro...	Mus musculus
BAE21972	6.9e-119	75.7	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan NULL 152 168 PR01217 NULL

NULL 185 197 PR01217 NULL

NULL 203 224 PR01217 NULL

NULL 232 248 PR01217 NULL

NULL 253 270 PR01217 NULL

HMMPfam IPR007087 747 769 PF00096 Zinc finger

HMMSmart IPR015880 23 46 SM00355 Zinc finger

IPR015880 71 94 SM00355 Zinc finger

IPR015880 718 741 SM00355 Zinc finger

IPR015880 747 769 SM00355 Zinc finger

IPR015880 774 795 SM00355 Zinc finger

ProfileScan IPR007087 747 769 PS50157 Zinc finger

ScanRegExp IPR007087 749 769 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	152	168	PR01217	NULL
NULL	185	197	PR01217	NULL
NULL	203	224	PR01217	NULL
NULL	232	248	PR01217	NULL
NULL	253	270	PR01217	NULL
HMMPfam	IPR007087	747	769	PF00096	Zinc finger
HMMSmart	IPR015880	23	46	SM00355	Zinc finger
IPR015880	71	94	SM00355	Zinc finger
IPR015880	718	741	SM00355	Zinc finger
IPR015880	747	769	SM00355	Zinc finger
IPR015880	774	795	SM00355	Zinc finger
ProfileScan	IPR007087	747	769	PS50157	Zinc finger
ScanRegExp	IPR007087	749	769	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AATAGTTTGCAGCCTTCTCCC

Primer_r
: AAGATACAGAATGGAAGACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1040 bp
Genome contig ID	gi51511729f_114007344
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GTATCAACCAAATTAAAAAGAAAGGTTTTCATGTC
Flanking genome sequence (103556 - 103605)	----+--------+--------+--------+--------+----* AGCAACATCTTCATGTGTGTTTTCTTTTGTGTAGTTTTCATTGTATGATA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	f	114107344	114110898	1	100.0	Perfect prediction

Primer_f	: AATAGTTTGCAGCCTTCTCCC
Primer_r	: AAGATACAGAATGGAAGACTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1802

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information