HUGE

Gene/Protein Characteristic Table for KIAA1817

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00926
Accession No. :	AB058720
Description :	FERM and PDZ domain-containing protein 3.
HUGO Gene Name :	FERM and PDZ domain containing 3 (FRMPD3)
Clone Name :	fj14474 [Vector Info]
Flexi ORF Clone :	pF1KSDA1817
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4928 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1876 bp

Genome contig ID gi89161218f_106630291
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
ACAAGAATGATTAAATCTATTCATCTTACTATCCC
Flanking genome sequence
(104846 - 104895)
----+----*----+----*----+----*----+----*----+----*
AATAAGTCTTTGCGGTGCCTCTTTGTGGGTGTCCTTGTGTCCTTGAATTG

Features of the protein sequence	Description

Length: 997 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX02712	99.9	hCG1998501 [Hom...	Homo sapiens
CAI42749	99.9	FERM and PDZ do...	Homo sapiens
Q5JV73	99.9	FERM and PDZ do...	Homo sapiens
EDL23927	86.6	hypothetical pr...	Mus musculus
EDL78972	86.8	rCG27110 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGCTTTGTGGTCCTTGCATC

Primer_r
: CTGCAGCCCTTAAGAGAGAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: CCR
Primer_f	: GAGCTTTGTGGTCCTTGCATC
Primer_r	: CTGCAGCCCTTAAGAGAGAAC
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec128 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1876 bp
Genome contig ID	gi89161218f_106630291
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACAAGAATGATTAAATCTATTCATCTTACTATCCC
Flanking genome sequence (104846 - 104895)	----+--------+--------+--------+--------+----* AATAAGTCTTTGCGGTGCCTCTTTGTGGGTGTCCTTGTGTCCTTGAATTG

Gene/Protein Characteristic Table for KIAA1817

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information