HUGE

Gene/Protein Characteristic Table for KIAA1818

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04900
Accession No. :	AB058721
Description :	E1A-binding protein p400.
HUGO Gene Name :
Clone Name :	hg00622 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6267 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2793 bp

Genome contig ID gi89161190f_130982598
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
AAGGCAAAATAAAGTGACCTTTTTATATATTTTTT
Flanking genome sequence
(148368 - 148417)
----+----*----+----*----+----*----+----*----+----*
CATTTTGTCTTTCATAGAAAACTGGTATTTAAGTTAAATGAGATGCTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 131082598 131130964 24 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1157 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10081	100.0	E1A binding pro...	synthetic construct
Q96L91	100.0	E1A-binding pro...	Homo sapiens
NP_056224	99.9	E1A binding pro...	Homo sapiens
AAK97789	99.6	p400 SWI2/SNF2-...	Homo sapiens
XP_001105690	98.2	similar to E1A ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001005 357 426 PS50090 SANT

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001005	357	426	PS50090	SANT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTGTCAGACTCTAATTGGCG

Primer_r
: TGTCTTATCAGGCACCAAATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACTGTCAGACTCTAATTGGCG
Primer_r	: TGTCTTATCAGGCACCAAATC
PCR product length	: 95 bp
PCR conditions	: 15 °C62 sec60 °C30 sec169 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2793 bp
Genome contig ID	gi89161190f_130982598
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAGGCAAAATAAAGTGACCTTTTTATATATTTTTT
Flanking genome sequence (148368 - 148417)	----+--------+--------+--------+--------+----* CATTTTGTCTTTCATAGAAAACTGGTATTTAAGTTAAATGAGATGCTGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	131082598	131130964	24	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1818

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information