HUGE

Gene/Protein Characteristic Table for KIAA1836

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB058739
Description :	Coiled-coil and C2 domain-containing protein 1B.
HUGO Gene Name :	coiled-coil and C2 domain containing 1B (CC2D1B)
Clone Name :	fh12206 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5482 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 2924 bp

Genome contig ID gi89161185r_52488855
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GCAAACTGAATAAACTACAGAAATTTTTTAGAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAGTCTTGCTTACAATTAAAGGGCAAACTCCTGTGACTCTAACATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 52588855 52599292 20 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 718 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX06786	1.2e-216	100.0	coiled-coil and...	Homo sapiens
Q5T0F9	1.2e-216	100.0	Coiled-coil and...	Homo sapiens
XP_513407	1.2e-215	99.7	coiled-coil and...	Pan troglodytes
CAI12284	3.2e-213	99.2	coiled-coil and...	Homo sapiens
EAX06787	1.4e-204	99.1	coiled-coil and...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000008 561 659 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR006608 28 85 SM00685 Protein of unknown function DM14

IPR006608 141 198 SM00685 Protein of unknown function DM14

IPR006608 245 303 SM00685 Protein of unknown function DM14

IPR006608 397 455 SM00685 Protein of unknown function DM14

IPR000008 560 674 SM00239 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	561	659	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR006608	28	85	SM00685	Protein of unknown function DM14
IPR006608	141	198	SM00685	Protein of unknown function DM14
IPR006608	245	303	SM00685	Protein of unknown function DM14
IPR006608	397	455	SM00685	Protein of unknown function DM14
IPR000008	560	674	SM00239	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGTAGCAGTAACATGACAAAC

Primer_r
: TCATAGTCTCCATCCATTCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	2924 bp
Genome contig ID	gi89161185r_52488855
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- GCAAACTGAATAAACTACAGAAATTTTTTAGAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAGTCTTGCTTACAATTAAAGGGCAAACTCCTGTGACTCTAACATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	52588855	52599292	20	99.4	Perfect prediction

Primer_f	: GGTAGCAGTAACATGACAAAC
Primer_r	: TCATAGTCTCCATCCATTCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1836

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information