HUGE |
Gene/Protein Characteristic Table for KIAA1847 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK00286 |
---|---|
Accession No. : | AB058750 |
Description : | Zinc finger CCCH-type with G patch domain-containing protein. |
HUGO Gene Name : | |
Clone Name : | bm00425 [Vector Info] |
Flexi ORF Clone : | pF1KA1847 |
Source : | Human adult brain |
Note : | We replaced fh03725, former representative clones for KIAA1847 with bm00425. (2001/6/05) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1881 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 222 bp Genome contig ID gi51511747f_61709261 PolyA signal sequence
(ATTAAA,-25) +----*----+----*----+----*----+----
TGGCAAGGACATTAAAGTGATTTCATCACAGTGTCFlanking genome sequence
(128678 - 128727) ----+----*----+----*----+----*----+----*----+----*
ATTCAGTGGAGATCAGCTGGCTGCAGGGTCTCTGGGGAGAGAAGGGTCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 61809254 61837937 7 99.3 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 552 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |