HUGE

Gene/Protein Characteristic Table for KIAA1847

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence

Product ID :	ORK00286
Accession No. :	AB058750
Description :	Zinc finger CCCH-type with G patch domain-containing protein.
HUGO Gene Name :
Clone Name :	bm00425 [Vector Info]
Flexi ORF Clone :	pF1KA1847
Source :	Human adult brain
Note :	We replaced fh03725, former representative clones for KIAA1847 with bm00425. (2001/6/05)

Features of the cloned DNA sequence	Description

Length: 1881 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 222 bp

Genome contig ID gi51511747f_61709261
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
TGGCAAGGACATTAAAGTGATTTCATCACAGTGTC
Flanking genome sequence
(128678 - 128727)
----+----*----+----*----+----*----+----*----+----*
ATTCAGTGGAGATCAGCTGGCTGCAGGGTCTCTGGGGAGAGAAGGGTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 61809254 61837937 7 99.3 Terminal No-hit

Features of the protein sequence	Description

Length: 552 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH32612	2.7e-173	100.0	Zinc finger, CC...	Homo sapiens
CAC03670	7.4e-173	99.8	zinc finger, CC...	Homo sapiens
XP_001113808	7.1e-153	97.0	similar to zinc...	Macaca mulatta
EDL07411	5.1e-138	79.1	zinc finger, CC...	Mus musculus
Q8VDM1	1e-137	79.9	Zinc finger CCC...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 216 241 PF00642 Zinc finger

IPR000467 354 398 PF01585 D111/G-patch

HMMSmart IPR000571 216 241 SM00356 Zinc finger

IPR000467 352 398 SM00443 D111/G-patch

ProfileScan IPR000467 354 400 PS50174 D111/G-patch

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	216	241	PF00642	Zinc finger
IPR000467	354	398	PF01585	D111/G-patch
HMMSmart	IPR000571	216	241	SM00356	Zinc finger
IPR000467	352	398	SM00443	D111/G-patch
ProfileScan	IPR000467	354	400	PS50174	D111/G-patch

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	222 bp
Genome contig ID	gi51511747f_61709261
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- TGGCAAGGACATTAAAGTGATTTCATCACAGTGTC
Flanking genome sequence (128678 - 128727)	----+--------+--------+--------+--------+----* ATTCAGTGGAGATCAGCTGGCTGCAGGGTCTCTGGGGAGAGAAGGGTCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	61809254	61837937	7	99.3	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1847

Features of the cloned DNA sequence

Features of the protein sequence