HUGE

Gene/Protein Characteristic Table for KIAA1858

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05723
Accession No. :	AB058761
Description :
HUGO Gene Name :	zinc finger protein 469 (ZNF469)
Clone Name :	ae00147 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced fh12352, former representative clones for KIAA1858 with ae00147. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 8855 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1443 bp

Genome contig ID gi51511732f_86925830
PolyA signal sequence
(AATATA,-24)
+----*----+----*----+----*----+----
TTGTCTTTTCAAATATATTCCCACTATTTTCGCAG
Flanking genome sequence
(108830 - 108879)
----+----*----+----*----+----*----+----*----+----*
AAAACCTCCAGCTGCGTGACGTCTGTCCTCCCGCCGGCCCCCATCCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 87025830 87034658 2 99.0 Internal No-hit

Features of the protein sequence	Description

Length: 2469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JG9	0	99.8	Zinc finger pro...	Homo sapiens
XP_523457	0	97.2	zinc finger pro...	Pan troglodytes
XP_001098268	0	88.2	zinc finger pro...	Macaca mulatta
EAW66812	2.7e-215	99.9	hCG1979743, iso...	Homo sapiens
XP_546786	2.8e-177	50.1	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007087 1631 1653 PF00096 Zinc finger

IPR007087 1853 1875 PF00096 Zinc finger

IPR007087 1934 1956 PF00096 Zinc finger

HMMSmart IPR015880 988 1011 SM00355 Zinc finger

IPR015880 1631 1653 SM00355 Zinc finger

IPR015880 1659 1683 SM00355 Zinc finger

IPR015880 1691 1713 SM00355 Zinc finger

IPR015880 1853 1875 SM00355 Zinc finger

IPR015880 1881 1904 SM00355 Zinc finger

IPR015880 1934 1956 SM00355 Zinc finger

ProfileScan IPR007087 1631 1658 PS50157 Zinc finger

IPR007087 1853 1880 PS50157 Zinc finger

IPR007087 1934 1963 PS50157 Zinc finger

ScanRegExp IPR007087 990 1011 PS00028 Zinc finger

IPR007087 1633 1653 PS00028 Zinc finger

IPR007087 1693 1713 PS00028 Zinc finger

IPR007087 1855 1875 PS00028 Zinc finger

IPR007087 1883 1904 PS00028 Zinc finger

IPR007087 1936 1956 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	1631	1653	PF00096	Zinc finger
IPR007087	1853	1875	PF00096	Zinc finger
IPR007087	1934	1956	PF00096	Zinc finger
HMMSmart	IPR015880	988	1011	SM00355	Zinc finger
IPR015880	1631	1653	SM00355	Zinc finger
IPR015880	1659	1683	SM00355	Zinc finger
IPR015880	1691	1713	SM00355	Zinc finger
IPR015880	1853	1875	SM00355	Zinc finger
IPR015880	1881	1904	SM00355	Zinc finger
IPR015880	1934	1956	SM00355	Zinc finger
ProfileScan	IPR007087	1631	1658	PS50157	Zinc finger
IPR007087	1853	1880	PS50157	Zinc finger
IPR007087	1934	1963	PS50157	Zinc finger
ScanRegExp	IPR007087	990	1011	PS00028	Zinc finger
IPR007087	1633	1653	PS00028	Zinc finger
IPR007087	1693	1713	PS00028	Zinc finger
IPR007087	1855	1875	PS00028	Zinc finger
IPR007087	1883	1904	PS00028	Zinc finger
IPR007087	1936	1956	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAGCCCTTTTGAGACCACAC

Primer_r
: CAACAGCAGCAAGACTAAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCAGCCCTTTTGAGACCACAC
Primer_r	: CAACAGCAGCAAGACTAAGAG
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec222 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1443 bp
Genome contig ID	gi51511732f_86925830
PolyA signal sequence (AATATA,-24)	+--------+--------+----*----+---- TTGTCTTTTCAAATATATTCCCACTATTTTCGCAG
Flanking genome sequence (108830 - 108879)	----+--------+--------+--------+--------+----* AAAACCTCCAGCTGCGTGACGTCTGTCCTCCCGCCGGCCCCCATCCCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	87025830	87034658	2	99.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA1858

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information