HUGE |
Gene/Protein Characteristic Table for KIAA1863 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05724 |
---|---|
Accession No. : | AB058766 |
Description : | |
HUGO Gene Name : | |
Clone Name : | fj07583 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4270 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2829 bp Genome contig ID gi51511734r_71306834 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CATGCGGGAGCCGGTGTTTGAGTTCGTGCGGCCGCFlanking genome sequence
(99793 - 99744) ----+----*----+----*----+----*----+----*----+----*
CCCCTTACCACCCCAAGCAGAAGCGCTTCCCCCACCGGCAGCCCCTGCGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 71406627 71437805 32 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 452 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GTGACATCGACTTGAGCAACC | |
: CAGCCCAATATCAATCTTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |