HUGE

Gene/Protein Characteristic Table for KIAA1864

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05476
Accession No. :	AB058767
Description :	Hydrocephalus-inducing protein homolog.
HUGO Gene Name :
Clone Name :	fj07836 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4599 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 909 bp

Genome contig ID gi51511732r_69385229
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTCAGCAACAGAGCGAGACCCTGTCTC
Flanking genome sequence
(99711 - 99662)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAAAGTAACACAAAATCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 r 69484940 69565334 20 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL11459	4.5e-165	73.7	mCG132588 [Mus ...	Mus musculus
EDL92538	8.6e-165	73.1	rCG51059 [Rattu...	Rattus norvegicus
XP_511085	2.8e-148	86.8	similar to hydr...	Pan troglodytes
Q4G0P3	4.5e-148	86.8	Hydrocephalus-i...	Homo sapiens
XP_001498384	2.2e-120	68.7	hydrocephalus i...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCGGTTGGAGGTTTTAGATGC

Primer_r
: CGCGATCTCATATTTCCCACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: "1,16"

Experimental conditions

Panel name	: CCR
Primer_f	: ACAGACCTGGACAACTTCAAC
Primer_r	: GTATGGGTAAGTGCAGATGCC
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec216(400) cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	909 bp
Genome contig ID	gi51511732r_69385229
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTCAGCAACAGAGCGAGACCCTGTCTC
Flanking genome sequence (99711 - 99662)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAAAGTAACACAAAATCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	r	69484940	69565334	20	99.0	Perfect prediction

Primer_f	: TCGGTTGGAGGTTTTAGATGC
Primer_r	: CGCGATCTCATATTTCCCACG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1864

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information