HUGE

Gene/Protein Characteristic Table for KIAA1899

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00945
Accession No. :	AB067486
Description :	Gamma-tubulin complex component 5.
HUGO Gene Name :	tubulin, gamma complex associated protein 5 (TUBGCP5)
Clone Name :	fk06803s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1899
Source :	Human fetal brain
Note :	We replaced fk06803, former representative clones for KIAA1899 with fk06803s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 3761 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 642 bp

Genome contig ID gi51511731f_20284923
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
ACTGATATTCAAAATAAATTAAAGGACTTAAAATC
Flanking genome sequence
(140410 - 140459)
----+----*----+----*----+----*----+----*----+----*
ATTTTATTATCCTTTTGCTGCTGTCCTACAGTCACAGAAGCTTTTTATAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 20384922 20425331 23 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96RT8	100.0	Gamma-tubulin c...	Homo sapiens
BAF82548	99.9	unnamed protein...	Homo sapiens
AAH71560	99.9	Tubulin, gamma ...	Homo sapiens
NP_001096080	99.6	tubulin, gamma ...	Homo sapiens
XP_536154	92.8	similar to Gamm...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007259 278 922 PF04130 Spc97/Spc98

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007259	278	922	PF04130	Spc97/Spc98

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAGGAACTTGCAGAAATTGAG

Primer_r
: AGGGTGTTAAGCAGGTGAGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	642 bp
Genome contig ID	gi51511731f_20284923
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACTGATATTCAAAATAAATTAAAGGACTTAAAATC
Flanking genome sequence (140410 - 140459)	----+--------+--------+--------+--------+----* ATTTTATTATCCTTTTGCTGCTGTCCTACAGTCACAGAAGCTTTTTATAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	20384922	20425331	23	99.9	Perfect prediction

Primer_f	: GAGGAACTTGCAGAAATTGAG
Primer_r	: AGGGTGTTAAGCAGGTGAGAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1899

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information