HUGE |
Gene/Protein Characteristic Table for KIAA1899 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00945 |
---|---|
Accession No. : | AB067486 |
Description : | Gamma-tubulin complex component 5. |
HUGO Gene Name : | tubulin, gamma complex associated protein 5 (TUBGCP5) |
Clone Name : | fk06803s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1899 |
Source : | Human fetal brain |
Note : | We replaced fk06803, former representative clones for KIAA1899 with fk06803s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3761 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 642 bp Genome contig ID gi51511731f_20284923 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ACTGATATTCAAAATAAATTAAAGGACTTAAAATCFlanking genome sequence
(140410 - 140459) ----+----*----+----*----+----*----+----*----+----*
ATTTTATTATCCTTTTGCTGCTGTCCTACAGTCACAGAAGCTTTTTATAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 20384922 20425331 23 99.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1032 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GAGGAACTTGCAGAAATTGAG | |
: AGGGTGTTAAGCAGGTGAGAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |