HUGE

Gene/Protein Characteristic Table for KIAA1915

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06089
Accession No. :	AB067502
Description :	Protein MYSM1.
HUGO Gene Name :	myb-like, SWIRM and MPN domains 1 (MYSM1)
Clone Name :	hf00664 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 7801 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5265 bp

Genome contig ID gi89161185r_58793000
PolyA signal sequence
(AATAAA,-9)
+----*----+----*----+----*----+----
AAATTCCATAAAAATAAAATTTTGAAAATAAAGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCATTTGGATTATTTCTAAATTATTAGCAATATACACATTGAATTGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 58893000 58927922 16 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VVJ2	99.9	Protein MYSM1; ...	Homo sapiens
XP_513441	99.7	hypothetical pr...	Pan troglodytes
XP_001110190	97.4	similar to myb-...	Macaca mulatta
XP_546688	86.8	similar to CG47...	Canis lupus fam...
XP_001914709	86.3	myb-like, SWIRM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014778 16 61 PF00249 Myb

IPR007526 270 359 PF04433 SWIRM

IPR000555 470 580 PF01398 Mov34/MPN/PAD-1

HMMSmart IPR001005 15 63 SM00717 SANT

IPR000555 474 606 SM00232 Mov34/MPN/PAD-1

ProfileScan IPR001005 11 61 PS50090 SANT

IPR007526 270 368 PS50934 SWIRM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	16	61	PF00249	Myb
IPR007526	270	359	PF04433	SWIRM
IPR000555	470	580	PF01398	Mov34/MPN/PAD-1
HMMSmart	IPR001005	15	63	SM00717	SANT
IPR000555	474	606	SM00232	Mov34/MPN/PAD-1
ProfileScan	IPR001005	11	61	PS50090	SANT
IPR007526	270	368	PS50934	SWIRM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGGAATAATAGTTGATGCCAG

Primer_r
: TTCCTCATGGCTTTCCTCTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5265 bp
Genome contig ID	gi89161185r_58793000
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- AAATTCCATAAAAATAAAATTTTGAAAATAAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATTTGGATTATTTCTAAATTATTAGCAATATACACATTGAATTGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	58893000	58927922	16	99.2	Perfect prediction

Primer_f	: GGGAATAATAGTTGATGCCAG
Primer_r	: TTCCTCATGGCTTTCCTCTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1915

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information