HUGE

Gene/Protein Characteristic Table for KIAA1917

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00950
Accession No. :	AB067504
Description :	RING finger protein 157.
HUGO Gene Name :	ring finger protein 157 (RNF157)
Clone Name :	fk00028 [Vector Info]
Flexi ORF Clone :	pF1KSDA1917
Source :	Human fetal brain
Note :	We replaced hj00666, former representative clones for KIAA1917 with fk00028. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3570 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1461 bp

Genome contig ID gi51511734r_71551583
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TACAAGATTGAAAAGATCGAAACTCTGTCTCAAAC
Flanking genome sequence
(99868 - 99819)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATTCAAGGCTGTTTCCAAGGCAGCCTCAAAAAGAGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 71651451 71747985 19 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PX1	100.0	RING finger pro...	Homo sapiens
EAW89378	99.9	ring finger pro...	Homo sapiens
XP_001097963	96.5	similar to ring...	Macaca mulatta
XP_584356	92.4	similar to ring...	Bos taurus
CAM16808	92.5	ring finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011116	5.1e-58	57.4	KIAA0544

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 300 338 PF00097 Zinc finger

HMMSmart IPR001841 300 338 SM00184 Zinc finger

ProfileScan IPR001841 300 339 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	300	338	PF00097	Zinc finger
HMMSmart	IPR001841	300	338	SM00184	Zinc finger
ProfileScan	IPR001841	300	339	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCCAGTAAAGCTAAAGTCC

Primer_r
: AGGCTGTTGTCTTTGGGAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1461 bp
Genome contig ID	gi51511734r_71551583
PolyA signal sequence (None)	+--------+--------+----*----+---- TACAAGATTGAAAAGATCGAAACTCTGTCTCAAAC
Flanking genome sequence (99868 - 99819)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATTCAAGGCTGTTTCCAAGGCAGCCTCAAAAAGAGCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	71651451	71747985	19	99.5	Perfect prediction

Primer_f	: AGGCCAGTAAAGCTAAAGTCC
Primer_r	: AGGCTGTTGTCTTTGGGAATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1917

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information