HUGE

Gene/Protein Characteristic Table for KIAA1920

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05729
Accession No. :	AB067507
Description :
HUGO Gene Name :
Clone Name :	ae00146 [Vector Info]
Source :	Human brain (amygdala)

Features of the cloned DNA sequence	Description

Length: 8556 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2149 bp

Genome contig ID gi51511731f_80821533
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TGACCCGTGACCCTCTTCCAAGAACATTCACTCTG
Flanking genome sequence
(1922485 - 1922436)
----+----*----+----*----+----*----+----*----+----*
ATTTCCAGTGTGCCCTGTTTCCCTTTCCAAATGGCTGGAGAGTGGGGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 82744018 82757403 4 99.0 Perfect prediction

ContigView(URL based/DAS) 15 f 80921510 80939559 11 97.1 Internal No-hit

ContigView(URL based/DAS) 15 f 80534979 80552975 12 97.0 Internal No-hit

ContigView(URL based/DAS) 15 f 83532010 83550007 13 97.0 Internal No-hit

Features of the protein sequence	Description

Length: 445 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW99239	2.5e-154	85.7	chondroitin sul...	Homo sapiens
Q6UVK1	2.5e-154	85.7	Chondroitin sul...	Homo sapiens
CAA65529	3.5e-154	85.2	melanoma-associ...	Homo sapiens
XP_001144835	5.5e-154	85.7	melanoma-associ...	Pan troglodytes
XP_001106160	6e-147	83.4	similar to mela...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTGTCAGTGATGGCTTGGTTG

Primer_r
: TGTTCCAGGATCACCATAAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2149 bp
Genome contig ID	gi51511731f_80821533
PolyA signal sequence (None)	+--------+--------+----*----+---- TGACCCGTGACCCTCTTCCAAGAACATTCACTCTG
Flanking genome sequence (1922485 - 1922436)	----+--------+--------+--------+--------+----* ATTTCCAGTGTGCCCTGTTTCCCTTTCCAAATGGCTGGAGAGTGGGGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	82744018	82757403	4	99.0	Perfect prediction
ContigView(URL based/DAS)	15	f	80921510	80939559	11	97.1	Internal No-hit
ContigView(URL based/DAS)	15	f	80534979	80552975	12	97.0	Internal No-hit
ContigView(URL based/DAS)	15	f	83532010	83550007	13	97.0	Internal No-hit

Primer_f	: GTGTCAGTGATGGCTTGGTTG
Primer_r	: TGTTCCAGGATCACCATAAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1920

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information