HUGE

Gene/Protein Characteristic Table for KIAA1927

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01185
Accession No. :	AB067514
Description :	Sperm-specific antigen 2.
HUGO Gene Name :
Clone Name :	hj03131 [Vector Info]
Flexi ORF Clone :	pF1KA1927
Source :	Human adult brain
Note :	We replaced ah01387, former representative clones for KIAA1927 with hj03131. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 5167 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1188 bp

Genome contig ID gi89161199f_182364915
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATATATATTAAAACAATAAAGTATTTATTTTGCCT
Flanking genome sequence
(138794 - 138843)
----+----*----+----*----+----*----+----*----+----*
AAAGTGTTTTAGTGGTTTCTTAAACTGCAACATGAAGATTTTGAATTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 182464840 182503707 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11373	100.0	sperm-specific ...	synthetic construct
P28290	99.9	Sperm-specific ...	Homo sapiens
AAH28706	99.8	Sperm specific ...	Homo sapiens
XP_001101290	96.5	similar to sper...	Macaca mulatta
BAC05027	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018291	3.4e-09	30.6	KIAA0748

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 1059 1325 PD120214 NULL

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	1059	1325	PD120214	NULL

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GCAAGTCAGCATTCCGATAGC

Primer_r
: TAACTGTTGTCTCACTGTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1188 bp
Genome contig ID	gi89161199f_182364915
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATATATATTAAAACAATAAAGTATTTATTTTGCCT
Flanking genome sequence (138794 - 138843)	----+--------+--------+--------+--------+----* AAAGTGTTTTAGTGGTTTCTTAAACTGCAACATGAAGATTTTGAATTAGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	182464840	182503707	18	99.5	Perfect prediction

Primer_f	: GCAAGTCAGCATTCCGATAGC
Primer_r	: TAACTGTTGTCTCACTGTCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1927

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information