| HUGE |
Gene/Protein Characteristic Table for KIAA1992 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07240 |
|---|---|
| Accession No. : | AB082523 |
| Description : | Tetratricopeptide repeat protein 21B. |
| HUGO Gene Name : | |
| Clone Name : | bg00166 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6583 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4021 bp Genome contig ID gi89161199r_166322234 PolyA signal sequence
(AATATA,-28) +----*----+----*----+----*----+----
TTTTAAAAATATAATACAACTGAGAAGTCTTCATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATTGTTCTGGTGGTCCTACCTGTTTTCTGTTAGGGATCCAATACATCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 166422234 166489431 21 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 853 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GAGTTTGAGAAGAGTTGGCTG | |
| : CATCTCATAGTTCAAGGCAGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 2 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |