HUGE |
Gene/Protein Characteristic Table for KIAA2008 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01642 |
---|---|
Accession No. : | AB235153 |
Description : | Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase B. |
HUGO Gene Name : | |
Clone Name : | fj04470 [Vector Info] |
Flexi ORF Clone : | pF1KSDA2008 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4491 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1538 bp Genome contig ID gi51511734f_72276133 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATTTCTTGAAATAATAAATATTTTATTGGGATGTGFlanking genome sequence
(181923 - 181972) ----+----*----+----*----+----*----+----*----+----*
AGGTGCAGAAGAGGAACTGTGCTGGATTCTCGTCTTTTCCTGCGGCATCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 72376133 72458054 17 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 793 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: | |
: | |
: °C |
RH mapping information |
Description | |
---|---|---|
: |
: | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |