HUGE |
Gene/Protein Characteristic Table for KIAA2031 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK05974 |
---|---|
Accession No. : | AB107353 |
Description : | RNA-binding protein MEX3D. |
HUGO Gene Name : | mex-3 homolog D (C. elegans) (MEX3D) |
Clone Name : | ef03841 [Vector Info] |
Source : |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2441 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 892 bp Genome contig ID gi42406306r_1405672 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
AAAGCCTTCTTAATAAAGCCTCTTTTCTACATGTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGCACACGGCTTCAGCGTGGTGTGGGGGATGGGCACCAGGAGGGGAGACC
Chr f/r start end exon identity class ContigView(URL based/DAS) 19 r 1505672 1518650 2 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 515 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 19 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |