The cDNA fragment was originally inserted at the EcoRV-NotI site
of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) 
without using any linker or adapter and a RT-PCR product (1-1938)
was subcloned upstream of the cDNA (1939-6040). The adjacent
sequence to the 5' end of the cDNA is as follows:
GGGCCCCCCCTCGAGGTCGACGGTATCGATAAGCTGGCCGCGAATTCACT
AGTGATT-5' end of cDNA.