The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-1846) was subcloned upstream of the cDNA (1847-7545). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGCTGAAGCTTTCACAAGTTTGTACAAAAAAGCAGGCTCTTC-5' end of cDNA. |
| Back |