Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00003 |
---|---|
Accession No | D13640 |
Description | protein phosphatase, Mg2+/Mn2+ dependent, 1F |
Clone name | ha00478 |
Vector information | |
cDNA sequence | DNA sequence (5134 bp) Predicted protein sequence (480 aa) |
HaloTag ORF Clone |
FHC00003
|
Flexi ORF Clone | FXC00003 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0015
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3663 bp |
---|---|
Genome contig ID | gi89161203r_20503800 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 22 | r | 20603800 | 20637209 | 8 | 99.2 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CTCCTCTCCTCTCCTATGGT |
Primer_r | AGGCAGAATCAAACCAAAAA |
PCR product length | 170 bp |
PCR conditions | 95 °C15 sec58 °C60 sec30 cycles |