KIAA0015

Product ID	ORK00003
Accession No	D13640
Description	protein phosphatase, Mg2+/Mn2+ dependent, 1F
Clone name	ha00478
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5134 bp) Predicted protein sequence (480 aa)
HaloTag ORF Clone	FHC00003
Flexi ORF Clone	FXC00003
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0015 by Kazusa Mouse cDNA Project

Length: 5134 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3663 bp
Genome contig ID	gi89161203r_20503800
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CACCATGCAGAAGTGTCAATAAACCACAAGTTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTCTGTCGCCCGAGTCCTGCCTTCTTCCTGACTTCTGAGCATCTTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	20603800	20637209	8	99.2	Perfect prediction

Length: 480 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P49593	1.9e-175	100.0	Protein phospha...	Homo sapiens
BAF84317	5.9e-175	99.8	unnamed protein...	Homo sapiens
AAL15579	6.8e-175	99.8	hFEM-2 [Homo sa...	Homo sapiens
AAH71989	2.4e-174	99.8	Protein phospha...	Homo sapiens
XP_001089477	6.8e-168	96.0	protein phospha...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028995	8.8e-47	47.1	KIAA1072

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014045	181	432	PF00481	Protein phosphatase 2C
HMMSmart	IPR001932	170	437	SM00332	Protein phosphatase 2C-related
HMMSmart	IPR001932	197	439	SM00331	Protein phosphatase 2C-related
ScanRegExp	IPR000222	219	227	PS01032	Protein phosphatase 2C

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTCCTCTCCTCTCCTATGGT
Primer_r	AGGCAGAATCAAACCAAAAA
PCR product length	170 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles