Order Kazusa clone(s) from : ![]() |
Product ID | ORK00730 |
---|---|
Accession No | AB028995 |
Description | protein phosphatase, Mg2+/Mn2+ dependent, 1E, transcript variant 1 |
Clone name | hj06360 |
Vector information | |
cDNA sequence | DNA sequence (5035 bp) Predicted protein sequence (759 aa) |
Flexi ORF Clone | FXC00730 |
Source | Human adult brain |
Rouge ID |
mKIAA1072
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2634 bp |
---|---|
Genome contig ID | gi51511734f_54088231 |
PolyA signal sequence (TATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (327579 - 327628) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 54188231 | 54415808 | 7 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | ACACATGCTAGGCTTTCTCAG |
---|---|
Primer_r | TAACGACCACACTAGAACTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |