Order Kazusa clone(s) from : ![]() |
Product ID | ORK00374 |
---|---|
Accession No | D21851 |
Description | leucyl-tRNA synthetase 2, mitochondrial |
Clone name | ha00560 |
Vector information | |
cDNA sequence | DNA sequence (4203 bp) Predicted protein sequence (904 aa) |
Flexi ORF Clone | FXC00374 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1306 bp |
---|---|
Genome contig ID | gi89161205f_45305079 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (260255 - 260304) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 45405079 | 45565332 | 22 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002302 | 177 | 194 | PR00985 | Leucyl-tRNA synthetase |
IPR002302 | 203 | 219 | PR00985 | Leucyl-tRNA synthetase | |
IPR002302 | 236 | 249 | PR00985 | Leucyl-tRNA synthetase | |
IPR002302 | 265 | 284 | PR00985 | Leucyl-tRNA synthetase | |
IPR002302 | 516 | 534 | PR00985 | Leucyl-tRNA synthetase | |
IPR002302 | 555 | 577 | PR00985 | Leucyl-tRNA synthetase | |
IPR002302 | 588 | 598 | PR00985 | Leucyl-tRNA synthetase | |
HMMPfam | IPR015413 | 85 | 167 | PF09334 | Aminoacyl-tRNA synthetase |
IPR002300 | 640 | 680 | PF00133 | Aminoacyl-tRNA synthetase | |
IPR013155 | 726 | 872 | PF08264 | Valyl/Leucyl/Isoleucyl-tRNA synthetase | |
HMMTigr | IPR002302 | 55 | 903 | TIGR00396 | Leucyl-tRNA synthetase |
ScanRegExp | IPR001412 | 92 | 103 | PS00178 | Aminoacyl-tRNA synthetase |
Panel name | Genebridge 4 |
---|---|
Primer_f | GGGAAGCCATCAGAGACACT |
Primer_r | CTGAAGGCAAAGAGACCATT |
PCR product length | 216 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |