KIAA0031

Product ID	ORK00375
Accession No	D21163
Description	elongation factor Tu GTP binding domain containing 2, transcript variant 1
Clone name	ha01047
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3784 bp) Predicted protein sequence (977 aa)
HaloTag ORF Clone	FHC00375
Flexi ORF Clone	FXC00375
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0031 by Kazusa Mouse cDNA Project

Length: 3784 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	805 bp
Genome contig ID	gi51511734r_40183363
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCCCCAGTGAAAAAGAGTCTGTTGATTTTCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTGCTTTATTAGGAATGTACCAGGGATTGAGTTAGGGGAGTTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	40283363	40332318	28	99.8	Perfect prediction

Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15029	100.0	116 kDa U5 smal...	Homo sapiens
XP_548058	99.9	similar to 116 ...	Canis lupus fam...
Q5R6E0	99.8	116 kDa U5 smal...	Pongo abelii
BAF85797	99.8	unnamed protein...	Homo sapiens
AAH02360	99.9	Elongation fact...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	136	149	PR00315	Protein synthesis factor
	IPR000795	181	189	PR00315	Protein synthesis factor
	IPR000795	206	216	PR00315	Protein synthesis factor
	IPR000795	222	233	PR00315	Protein synthesis factor
	IPR000795	258	267	PR00315	Protein synthesis factor
HMMPfam	IPR000795	132	447	PF00009	Protein synthesis factor
	IPR004161	494	571	PF03144	Translation elongation factor EFTu/EF1A
	IPR005517	710	829	PF03764	Translation elongation factor EFG/EF2
	IPR000640	831	920	PF00679	Translation elongation factor EFG/EF2
HMMTigr	IPR005225	132	306	TIGR00231	Small GTP-binding protein domain

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CAACTCACCAACCTCCAACC
Primer_r	GTTTCATCCCCTTCTCTTTC
PCR product length	138 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles