Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00377 |
---|---|
Accession No | D26067 |
Description | transmembrane protein 41B, transcript variant 1 |
Clone name | ha02009 |
Vector information | |
cDNA sequence | DNA sequence (3269 bp) Predicted protein sequence (335 aa) |
HaloTag ORF Clone |
FHC00377
|
Flexi ORF Clone | FXC00377 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0033
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2260 bp |
---|---|
Genome contig ID | gi51511727r_9159292 |
PolyA signal sequence (AATAAA,-30) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99995 - 99946) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 9259287 | 9292697 | 7 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR015414 | 173 | 294 | PF09335 | SNARE associated Golgi protein |
ScanRegExp | IPR002114 | 302 | 317 | PS00589 | Phosphotransferase system |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | VVSGEEVAPEVALAVAL | 17 | SECONDARY | 17 | 2 | 96 | MSLLILVSIFLSAAFVMFLVYKN | 118 | PRIMARY | 23 | 3 | 157 | VLVAYFATYIFLQTFAIPGSIFL | 179 | PRIMARY | 23 | 4 | 191 | LALFLVCLCSGLGASFCYMLSYL | 213 | PRIMARY | 23 | 5 | 270 | LKVFFIGTFLGVAPPSFVAIKAG | 292 | SECONDARY | 23 | 6 | 306 | SWNSIFILMILAVLSILPAIFQ | 327 | PRIMARY | 22 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | TAATCATCCTCAAAGCCTGTT |
Primer_r | TAAATAATCCTCACGCAAAAG |
PCR product length | 155 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |