KIAA0038

Product ID	ORK01656
Accession No	D26068
Description	eukaryotic translation initiation factor 4H, transcript variant 2
Clone name	ha01502
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2477 bp) Predicted protein sequence (230 aa)
HaloTag ORF Clone	FHC01656
Flexi ORF Clone	FXC01656
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0038 by Kazusa Mouse cDNA Project

Length: 2477 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1782 bp
Genome contig ID	gi89161213f_73126642
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTGAATGATCTTTTAAATAAAAGAAAACCTTACGT
Flanking genome sequence (122718 - 122767)	----+--------+--------+--------+--------+----* AATATTTAATGCTTGCCTTTATTTTTGAGTTCTTTTTAGCTGCTCATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	73226642	73249358	6	99.2	Perfect prediction
Ensembl gnome browser	7	r	27462523	27465001	1	98.0	Perfect prediction

Length: 230 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF75557	5.4e-88	100.0	wbscr1 [Homo sa...	Homo sapiens
BAE89020	6.2e-88	99.6	unnamed protein...	Macaca fascicularis
XP_527788	1.4e-87	99.6	similar to Wbsc...	Pan troglodytes
AAD34860	1.9e-87	99.1	Wbscr1 alternat...	Mus musculus
Q1JPH6	2.9e-87	99.1	Eukaryotic tran...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	46	115	PF00076	RNA recognition motif
HMMSmart	IPR000504	45	116	SM00360	RNA recognition motif
ProfileScan	IPR000504	44	120	PS50102	RNA recognition motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGGTCCTTTCCATTCCTATT
Primer_r	CTCCCTACCGCTCTTCCATA
PCR product length	131 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles