KIAA0043

Product ID	ORK00382
Accession No	D26362
Description	bromodomain containing 3
Clone name	ha01331
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3028 bp) Predicted protein sequence (731 aa)
HaloTag ORF Clone	FHC00382
Flexi ORF Clone	FXC00382
Source	Myeloblast cell line (KG-1)

Length: 3028 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	708 bp
Genome contig ID	gi89161216r_135787825
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGTTTCCATACACTGAAGCTTTTACCTCAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAGAAAAGATTTAAAAAAAAAAAAAAAGGAGACTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	135887825	135922913	12	99.9	Perfect prediction

Length: 731 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15059	3.4e-180	100.0	Bromodomain-con...	Homo sapiens
XP_001170299	1.9e-179	99.7	bromodomain con...	Pan troglodytes
XP_001099107	1.1e-178	99.0	similar to brom...	Macaca mulatta
XP_001170278	3.7e-177	98.9	bromodomain con...	Pan troglodytes
XP_001098998	1.3e-176	98.2	similar to brom...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	59	72	PR00503	Bromodomain
	IPR001487	75	91	PR00503	Bromodomain
	IPR001487	91	109	PR00503	Bromodomain
	IPR001487	384	403	PR00503	Bromodomain
HMMPfam	IPR001487	44	133	PF00439	Bromodomain
HMMPfam	IPR001487	320	408	PF00439	Bromodomain
HMMSmart	IPR001487	37	147	SM00297	Bromodomain
HMMSmart	IPR001487	313	422	SM00297	Bromodomain
ProfileScan	IPR001487	56	128	PS50014	Bromodomain
ProfileScan	IPR001487	331	403	PS50014	Bromodomain
ScanRegExp	IPR001487	61	120	PS00633	Bromodomain
ScanRegExp	IPR001487	336	395	PS00633	Bromodomain

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CGGACAGAACAGGACAGATGG
Primer_r	GGGGTCATCGGGTTAGCATTT
PCR product length	271 bp
PCR conditions	95 °C15 sec65 °C60 sec30 cycles