KIAA0049

Product ID	ORK00385
Accession No	D30756
Description	neighbor of BRCA1 gene 1, transcript variant 1
Clone name	ha01035
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4654 bp) Predicted protein sequence (969 aa)
HaloTag ORF Clone	FHC00385
Flexi ORF Clone	FXC00385
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0049 by Kazusa Mouse cDNA Project

Length: 4654 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1613 bp
Genome contig ID	gi51511734f_38476024
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAAGAATGGTGAAATAAATGTTCTTGGAAATTCC
Flanking genome sequence (243209 - 243258)	----+--------+--------+--------+--------+----* TACCCGGACTGGCTAGTCCTTGCGGAAGCAGCGTCCGGGCCCTCGGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	38576024	38719231	21	99.6	Perfect prediction

Length: 969 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS15047	100.0	migration-induc...	Homo sapiens
Q14596	99.9	Next to BRCA1 g...	Homo sapiens
BAF82694	99.8	unnamed protein...	Homo sapiens
XP_001155667	99.2	neighbor of BRC...	Pan troglodytes
XP_001155005	99.2	neighbor of BRC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000270	7	88	PF00564	Octicosapeptide/Phox/Bem1p
	IPR000433	214	257	PF00569	Zinc finger
	IPR000449	919	959	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR000270	7	88	SM00666	Octicosapeptide/Phox/Bem1p
HMMSmart	IPR000433	214	259	SM00291	Zinc finger
ProfileScan	IPR000433	214	260	PS50135	Zinc finger
ProfileScan	IPR000449	916	960	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000433	220	246	PS01357	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CGAAGAGAGCCCTGATAACAT
Primer_r	TGCTGTCCCTTCTGTCTGCTC
PCR product length	145 (0.9k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles