Order Kazusa clone(s) from : ![]() |
Product ID | ORK00389 |
---|---|
Accession No | D31887 |
Description | solute carrier family 39 (zinc transporter), member 14, transcript variant 1 |
Clone name | ha01020 |
Vector information | |
cDNA sequence | DNA sequence (4573 bp) Predicted protein sequence (531 aa) |
HaloTag ORF Clone |
FHC00389
![]() |
Flexi ORF Clone | FXC00389 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0062
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2975 bp |
---|---|
Genome contig ID | gi51511724f_22180763 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (155370 - 155419) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 22280763 | 22336131 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR003689 | 190 | 522 | PF02535 | Zinc/iron permease |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 190 | VEVWGYGLLCVTVISLCSLLGAS | 212 | PRIMARY | 23 | 2 | 225 | LLLYFIALAIGTLYSNALFQLIP | 247 | SECONDARY | 23 | 3 | 262 | KSAVVFGGFYLFFFTEKILKILL | 284 | SECONDARY | 23 |
---|
Panel name | Stanford G3 |
---|---|
Primer_f | TGTCAGGATGCTCACTTGTTC |
Primer_r | CAGTGGGGAAGAGGAGGTCAA |
PCR product length | 207 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |