Order Kazusa clone(s) from : ![]() |
Product ID | ORK06618 |
---|---|
Accession No | D31888 |
Description | REST corepressor 1 |
Clone name | ha00472 |
Vector information | |
cDNA sequence | DNA sequence (5241 bp) Predicted protein sequence (396 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0071
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4050 bp |
---|---|
Genome contig ID | gi51511730f_102029355 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (237291 - 237340) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 102129244 | 102266644 | 12 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | GTTTCCTCAGATACCACAGAC |
Primer_r | GAGCATCGCACAGGACCACTA |
PCR product length | 337 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |