KIAA1266

Product ID	ORK00789
Accession No	AB033092
Description	metastasis associated 1 family, member 3, transcript variant 1
Clone name	hj06235
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5484 bp) Predicted protein sequence (601 aa)
HaloTag ORF Clone	FHC00789
Flexi ORF Clone	FXC00789
Source	Human adult brain
Rouge ID	mKIAA1266 by Kazusa Mouse cDNA Project

Length: 5484 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3548 bp
Genome contig ID	gi89161199f_42548689
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTATTGTGTTTCCAATAAATTCCTGGAAATTTT
Flanking genome sequence (288903 - 288952)	----+--------+--------+--------+--------+----* GCCTGGTTTTATGCTGTTCTTTACTAGGATGATGGCTCAGGTGTAAGACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	42648689	42837590	17	99.3	Perfect prediction

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001110956	100.0	metastasis asso...	Macaca mulatta
Q9BTC8	99.8	Metastasis-asso...	Homo sapiens
XP_001110843	100.0	metastasis asso...	Macaca mulatta
XP_515434	99.8	metastasis asso...	Pan troglodytes
XP_532947	96.6	similar to Meta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007927	9.3e-19	26.3	KIAA0458
D31888	1.4e-05	26.6	KIAA0071
AB037764	5e-05	24.4	KIAA1343
AB046830	0.00013	23.7	KIAA1610
AB033019	0.00042	27.0	KIAA1193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	18	155	PF01426	Bromo adjacent region
	IPR000949	156	217	PF01448	ELM2
	IPR014778	276	322	PF00249	Myb
	IPR000679	386	423	PF00320	Zinc finger
HMMSmart	IPR001025	12	155	SM00439	Bromo adjacent region
	IPR001005	275	324	SM00717	SANT
	IPR000679	380	434	SM00401	Zinc finger
ProfileScan	IPR001025	12	155	PS51038	Bromo adjacent region
ProfileScan	IPR000949	156	267	PS51156	ELM2

Primer_f	CCTGTTCCTCTGCACTATGTC
Primer_r	CCTTACAGACAGACAATCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCTGTTCCTCTGCACTATGTC
Primer_r	CCTTACAGACAGACAATCCAC
PCR product length	137 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles