KIAA1610

Product ID	ORK05992
Accession No	AB046830
Description	mesoderm induction early response 1, transcriptional regulator
Clone name	fj11544
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4585 bp) Predicted protein sequence (484 aa)
Source	Human fetal brain
Rouge ID	mKIAA1610 by Kazusa Mouse cDNA Project

Length: 4585 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3128 bp
Genome contig ID	gi89161185f_67084469
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TATGTTTTGCAAAATAAAACTTGTTTTGTCACAAT
Flanking genome sequence (141834 - 141883)	----+--------+--------+--------+--------+----* ATTTTCTTTGCTATCGATGGATAATTAGGAGTGGGCACTTGGAATAACTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	67184469	67226301	11	99.1	Perfect prediction

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001163423	5.6e-169	100.0	mesoderm induct...	Pan troglodytes
EAX06509	5.8e-169	100.0	mesoderm induct...	Homo sapiens
AAM76041	5.8e-169	100.0	mesoderm induct...	Homo sapiens
AAM76040	5.9e-169	100.0	mesoderm induct...	Homo sapiens
CAI18875	6e-169	100.0	mesoderm induct...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033019	7.2e-32	44.6	KIAA1193

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	152	211	PF01448	ELM2
HMMPfam	IPR014778	257	303	PF00249	Myb
HMMSmart	IPR001005	256	305	SM00717	SANT
ProfileScan	IPR000949	152	250	PS51156	ELM2
ScanRegExp	IPR002048	4	16	PS00018	Calcium-binding EF-hand

Primer_f	TTTCAGTGGTTCTTGGTCCCC
Primer_r	GAACTCCACTACAAAATACGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-