KIAA1193

Product ID	ORK00759
Accession No	AB033019
Description	mesoderm induction early response 1, family member 2
Clone name	fg00739
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7118 bp) Predicted protein sequence (544 aa)
HaloTag ORF Clone	FHC00759
Flexi ORF Clone	FXC00759
Source	Human fetal brain
Rouge ID	mKIAA1193 by Kazusa Mouse cDNA Project

Length: 7118 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1337 bp
Genome contig ID	gi42406306r_152444
PolyA signal sequence (None)	+--------+--------+----*----+---- GGTGCATTTTAACAGATTTTGAAGTCTTGACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGCAGATATTTCTGTTTTCTTTTGCTTTCTTAGAGTTCCATTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	252444	287179	15	98.5	Internal No-hit

Length: 544 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N344	1.5e-200	100.0	Mesoderm induct...	Homo sapiens
XP_001090898	2.8e-190	95.6	similar to CG16...	Macaca mulatta
Q3U3N0	9.3e-158	81.3	Mesoderm induct...	Mus musculus
EDL31693	1.6e-157	80.7	mesoderm induct...	Mus musculus
AAH67013	3.1e-156	80.9	Mesoderm induct...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046830	3.5e-32	44.6	KIAA1610

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	194	252	PF01448	ELM2
HMMPfam	IPR014778	298	344	PF00249	Myb
HMMSmart	IPR001005	297	346	SM00717	SANT
ProfileScan	IPR000949	194	291	PS51156	ELM2

Primer_f	AGAGGAAGAGACGCAATCATC
Primer_r	AGCTGGTCTTCGTTCTCGTAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTAACGTGATGACCTGCTGAC
Primer_r	AGTCCTGACGTGTTCTGAAGC
PCR product length	161&(600) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles