Order Kazusa clone(s) from : ![]() |
Product ID | ORK06630 |
---|---|
Accession No | AB007927 |
Description | arginine-glutamic acid dipeptide (RE) repeats |
Clone name | ef01252 |
Vector information | |
cDNA sequence | DNA sequence (7341 bp) Predicted protein sequence (1552 aa) |
Source | |
Rouge ID |
mKIAA0458
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00715, former representative clones for KIAA0458 with ef01252. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2680 bp |
---|---|
Genome contig ID | gi89161185r_8235053 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 8335053 | 8638903 | 22 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001025 | 89 | 269 | PF01426 | Bromo adjacent region |
IPR000949 | 270 | 329 | PF01448 | ELM2 | |
IPR014778 | 379 | 425 | PF00249 | Myb | |
IPR000679 | 493 | 528 | PF00320 | Zinc finger | |
IPR002951 | 554 | 1552 | PF03154 | Atrophin | |
HMMSmart | IPR001025 | 89 | 269 | SM00439 | Bromo adjacent region |
IPR001005 | 378 | 427 | SM00717 | SANT | |
IPR000679 | 487 | 538 | SM00401 | Zinc finger | |
ProfileScan | IPR001025 | 89 | 269 | PS51038 | Bromo adjacent region |
IPR000949 | 270 | 373 | PS51156 | ELM2 |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACGATTTCTGGGTGTCTACTG |
Primer_r | CGTATCTTGTTCGGTGTCCTC |
PCR product length | 163 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |