KIAA0458

Product ID	ORK06630
Accession No	AB007927
Description	arginine-glutamic acid dipeptide (RE) repeats
Clone name	ef01252
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7341 bp) Predicted protein sequence (1552 aa)
Source
Rouge ID	mKIAA0458 by Kazusa Mouse cDNA Project
Note	We replaced hg00715, former representative clones for KIAA0458 with ef01252. (2005/08/06)

Length: 7341 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2680 bp
Genome contig ID	gi89161185r_8235053
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TATTTGTGGACATAAATAAAACCAAGCTACACTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTTGGGTGTCTCCCGTGCACTGTCTCATTCCTGGAGAGTGGGCGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	8335053	8638903	22	99.3	Perfect prediction

Length: 1552 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2R6	100.0	Arginine-glutam...	Homo sapiens
XP_001159355	99.7	atrophin-1 like...	Pan troglodytes
BAA95898	99.5	RERE [Homo sapi...	Homo sapiens
XP_001097280	99.4	similar to atro...	Macaca mulatta
XP_001159210	98.8	atrophin-1 like...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	2e-06	28.3	KIAA1681
AB051547	7.8e-05	24.9	KIAA1760
AB040955	0.00027	25.6	KIAA1522
AB040904	0.00046	25.7	KIAA1471
AB028999	0.0008	25.7	KIAA1076

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001025	89	269	PF01426	Bromo adjacent region
	IPR000949	270	329	PF01448	ELM2
	IPR014778	379	425	PF00249	Myb
	IPR000679	493	528	PF00320	Zinc finger
	IPR002951	554	1552	PF03154	Atrophin
HMMSmart	IPR001025	89	269	SM00439	Bromo adjacent region
	IPR001005	378	427	SM00717	SANT
	IPR000679	487	538	SM00401	Zinc finger
ProfileScan	IPR001025	89	269	PS51038	Bromo adjacent region
ProfileScan	IPR000949	270	373	PS51156	ELM2

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ACGATTTCTGGGTGTCTACTG
Primer_r	CGTATCTTGTTCGGTGTCCTC
PCR product length	163 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles