Order Kazusa clone(s) from : ![]() |
Product ID | ORK02051 |
---|---|
Accession No | AB051547 |
Description | WNK lysine deficient protein kinase 2 |
Clone name | af00030 |
Vector information | |
cDNA sequence | DNA sequence (7792 bp) Predicted protein sequence (2219 aa) |
HaloTag ORF Clone |
FHC02051
![]() |
Flexi ORF Clone | FXC02051 |
Source | Human brain (amygdala) |
Rouge ID |
mKIAA1760
by Kazusa Mouse cDNA Project
|
Note | We replaced fh22167, former representative clones for KIAA1760 with af00030. (2003/4/2) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1130 bp |
---|---|
Genome contig ID | gi89161216f_94887142 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (234167 - 234216) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 94987046 | 95121307 | 29 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 196 | 448 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 190 | 448 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 190 | 448 | SM00219 | Tyrosine protein kinase |
IPR002290 | 190 | 448 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 190 | 448 | PS50011 | Protein kinase |
ScanRegExp | IPR008271 | 314 | 326 | PS00108 | Serine/threonine protein kinase |
Primer_f | GTTAGAACCTTGTCGTCACCC |
---|---|
Primer_r | AACCATTCACATCTCTGCAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |