Gene/Protein Characteristic Table for KIAA1566
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07368
Accession No AB046786
Description WNK lysine deficient protein kinase 3
Clone name fh21445
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5844 bp)
Predicted protein sequence (1313 aa)
Source Human fetal brain
Features of the cloned cDNA sequence
Description

Length: 5844 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1901 bp
Genome contig ID gi89161218r_54139631
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACAGTCTACTTTGTGACATTAAGTACCTCTTTTCC
Flanking genome sequence
(99949 - 99900)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAATGTGTTTTATGTTGCTTACCTGAGGATCACATCCA
Features of the protein sequence
Description

Length: 1313 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BYP7 0 99.9 Serine/threonin...
Homo sapiens
XP_001146822 0 99.3 WNK lysine defi...
Pan troglodytes
XP_001089789 0 97.2 WNK lysine defi...
Macaca mulatta
XP_001495798 0 87.7 similar to Seri...
Equus caballus
XP_864627 0 84.3 similar to Seri...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051547 2.3e-15 25.5 KIAA1760
AB002342 1.7e-11 26.9 KIAA0344
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TCCACTCTGAAGACTTTAAGG
Primer_r TTTCGTCATTACCTGGCAAGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp