Order Kazusa clone(s) from : ![]() |
Product ID | ORK06786 |
---|---|
Accession No | AB028999 |
Description | SET domain containing 1B |
Clone name | hj06779 |
Vector information | |
cDNA sequence | DNA sequence (4833 bp) Predicted protein sequence (804 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1076
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2417 bp |
---|---|
Genome contig ID | gi89161190f_120641760 |
PolyA signal sequence (CATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (113186 - 113235) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 120741760 | 120754944 | 7 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | CCATCGTGCCCAGTGTTAACC |
---|---|
Primer_r | AATAGCAGAAACCCCCAACTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCATCGTGCCCAGTGTTAACC |
Primer_r | AATAGCAGAAACCCCCAACTC |
PCR product length | 185 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |