KIAA1076

Product ID	ORK06786
Accession No	AB028999
Description	SET domain containing 1B
Clone name	hj06779
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj06779 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGC GGACGCGTGG G) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (4833 bp) Predicted protein sequence (804 aa)
Source	Human adult brain
Rouge ID	mKIAA1076 by Kazusa Mouse cDNA Project

Length: 4833 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2417 bp
Genome contig ID	gi89161190f_120641760
PolyA signal sequence (CATAAA,-26)	+--------+--------+----*----+---- AAAGCAAACCATAAATATACTGACTTTTCTTACAG
Flanking genome sequence (113186 - 113235)	----+--------+--------+--------+--------+----* ATACGCCGTCTCTCTTGCTCTCCTCTCTCCCTCTCCTCTTTATTCTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	120741760	120754944	7	99.2	Perfect prediction

Length: 804 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW98290	2.6e-209	100.0	hCG1812756 [Hom...	Homo sapiens
Q9UPS6	3.9e-209	100.0	Histone-lysine ...	Homo sapiens
XP_543382	2e-182	88.7	similar to CG40...	Canis lupus fam...
AAH40775	1.8e-174	85.0	Setd1b protein ...	Mus musculus
AAH41681	1.8e-174	85.0	Setd1b protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002337	1.4e-25	40.8	KIAA0339
AB002302	8.4e-08	29.3	KIAA0304
AB007927	0.00026	25.8	KIAA0458

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	659	788	PF00856	SET
HMMSmart	IPR001214	665	788	SM00317	SET
HMMSmart	IPR003616	788	804	SM00508	Post-SET zinc-binding region
ProfileScan	IPR001214	664	786	PS50280	SET
ProfileScan	IPR003616	788	804	PS50868	Post-SET zinc-binding region

Primer_f	CCATCGTGCCCAGTGTTAACC
Primer_r	AATAGCAGAAACCCCCAACTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCATCGTGCCCAGTGTTAACC
Primer_r	AATAGCAGAAACCCCCAACTC
PCR product length	185 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles