KIAA1681

Product ID	ORK06593
Accession No	AB051468
Description	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Clone name	fh23697
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5135 bp) Predicted protein sequence (1236 aa)
Source	Human fetal brain

Length: 5135 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1424 bp
Genome contig ID	gi89161199r_203911003
PolyA signal sequence (None)	+--------+--------+----*----+---- TAACGACACACTAGTTCTAGATCGCGAGCGGCCGC
Flanking genome sequence (257277 - 257228)	----+--------+--------+--------+--------+----* AACACCCCAGAAATGGTAAAACTAGAAAGGAGAAGAGAGTGATTCTTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	204010992	204068279	13	99.3	Terminal No-hit

Length: 1236 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE48361	100.0	RAPH1 protein [...	Homo sapiens
Q70E73	99.9	Ras-associated ...	Homo sapiens
XP_516044	97.4	Ras association...	Pan troglodytes
EAW70345	95.9	Ras association...	Homo sapiens
XP_001173361	93.5	Ras association...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007927	2e-06	28.1	KIAA0458
D86962	1e-05	28.4	KIAA0207
AB040955	1.5e-05	25.7	KIAA1522
AB002302	8.7e-05	27.3	KIAA0304
AB067474	0.00046	26.6	KIAA1887

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001904	694	717	PR00832	Paxillin
	IPR001904	805	828	PR00832	Paxillin
	IPR001904	860	879	PR00832	Paxillin
HMMPfam	IPR000159	255	342	PF00788	Ras-association
HMMPfam	IPR001849	383	491	PF00169	Pleckstrin-like
HMMSmart	IPR000159	255	341	SM00314	Ras-association
HMMSmart	IPR001849	383	493	SM00233	Pleckstrin-like
ProfileScan	IPR000159	255	341	PS50200	Ras-association
ProfileScan	IPR001849	382	491	PS50003	Pleckstrin-like

Primer_f	TTCATTTATAGCTACTGGGGC
Primer_r	GCACTGACTCCACGTTATACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TTCATTTATAGCTACTGGGGC
Primer_r	GCACTGACTCCACGTTATACC
PCR product length	160 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles