KIAA1887

Product ID	ORK05943
Accession No	AB067474
Description	methyl-CpG binding domain protein 6
Clone name	fk02232
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3819 bp) Predicted protein sequence (967 aa)
Source	Human fetal brain

Length: 3819 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	914 bp
Genome contig ID	gi89161190f_56104767
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAATTTAACAGATGAGAATATTTTGAAACTCTG
Flanking genome sequence (105433 - 105482)	----+--------+--------+--------+--------+----* GCTCTGGCTCTGTACTCATTTTTTATTTAGTTCTTTGGTAAGAACAGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	56204765	56210198	10	99.9	Perfect prediction

Length: 967 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96DN6	100.0	Methyl-CpG-bind...	Homo sapiens
AAH65530	99.9	Methyl-CpG bind...	Homo sapiens
BAB71176	99.9	unnamed protein...	Homo sapiens
XP_849726	95.2	similar to meth...	Canis lupus fam...
XP_001917827	94.4	similar to Meth...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040894	1.6e-05	28.1	KIAA1461
AB051468	0.00011	26.6	KIAA1681
AB051547	0.00015	29.8	KIAA1760
AB002307	0.0002	28.4	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGTCTTCAGCCACTATGCACC
Primer_r	TGAGAGGGACGAAGTGATGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-