Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00401 |
---|---|
Accession No | D42043 |
Description | raftlin, lipid raft linker 1 |
Clone name | ha02022 |
Vector information | |
cDNA sequence | DNA sequence (2918 bp) Predicted protein sequence (648 aa) |
HaloTag ORF Clone |
FHC00401
|
Flexi ORF Clone | FXC00401 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0084
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 971 bp |
---|---|
Genome contig ID | gi89161205r_16232368 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 16332368 | 16530154 | 10 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Panel name | Genebridge 4 |
---|---|
Primer_f | CCCATGTATGCTGTGTTTATC |
Primer_r | TAAACAAGAGAAGAGACAGGC |
PCR product length | 135 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |