KIAA0103

Product ID	ORK00017
Accession No	D14659
Description	ER membrane protein complex subunit 2
Clone name	ha00802
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1219 bp) Predicted protein sequence (299 aa)
HaloTag ORF Clone	FHC00017
Flexi ORF Clone	FXC00017
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0103 by Kazusa Mouse cDNA Project

Length: 1219 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	319 bp
Genome contig ID	gi51511724f_109425058
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTGTTAAATAAACCATGATGATTTATTAAACTTGC
Flanking genome sequence (143266 - 143315)	----+--------+--------+--------+--------+----* ATATGAAGATTCTAACTTCATTTTGTTATACTCACAGTGGATATATTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	109525058	109568322	11	100.0	Perfect prediction

Length: 299 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001090826	7.7e-118	99.7	hypothetical pr...	Macaca mulatta
Q5R882	1.4e-117	99.7	Tetratricopepti...	Pongo abelii
AAH20753	1.6e-117	99.7	Tetratricopepti...	Homo sapiens
BAF83663	1.6e-117	99.7	unnamed protein...	Homo sapiens
XP_001495024	1.3e-116	99.3	similar to Tetr...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	89	122	PF07719	Tetratricopeptide TPR_2
HMMPfam	IPR013105	157	190	PF07719	Tetratricopeptide TPR_2
HMMSmart	IPR013026	89	122	SM00028	Tetratricopeptide region
	IPR013026	157	190	SM00028	Tetratricopeptide region
	IPR013026	194	227	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	89	122	PS50005	Tetratricopeptide region
	IPR013026	89	227	PS50293	Tetratricopeptide region
	IPR013026	157	190	PS50005	Tetratricopeptide region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CATTAGATTTCACAACTGCAC
Primer_r	CTCTCTTCCATGGATTTCCCC
PCR product length	184 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles