KIAA0106

Product ID	ORK00410
Accession No	D14662
Description	peroxiredoxin 6
Clone name	ha00683
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1653 bp) Predicted protein sequence (238 aa)
HaloTag ORF Clone	FHC00410
Flexi ORF Clone	FXC00410
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0106 by Kazusa Mouse cDNA Project

Length: 1653 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	935 bp
Genome contig ID	gi89161185f_171613117
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTTACTTTTTAGGGAACAAAATAAAATCCTTTGTT
Flanking genome sequence (111445 - 111494)	----+--------+--------+--------+--------+----* AAAACTGGGTCAGAGAATTCTGTTGTCATATTTTGAAGTATCAGATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	171713117	171724560	5	99.4	Perfect prediction

Length: 238 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5R7E0	7.6e-97	99.1	Peroxiredoxin-6.	Pongo abelii
XP_001101473	1.5e-96	98.7	peroxiredoxin 6...	Macaca mulatta
Q2PFL9	3.9e-96	98.2	Peroxiredoxin-6.	Macaca fascicularis
1PRX	1.2e-95	99.1	HORF6 A NOVEL H...	Homo sapiens
O77834	7.2e-94	95.1	Peroxiredoxin-6...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000866	21	160	PF00578	Alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGAAGAGCAGGGAAAGAGACC
Primer_r	ATTGCTCACACCTGCTACACC
PCR product length	129 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles