KIAA0107

Product ID	ORK01960
Accession No	D14663
Description	proteasome 26S subunit, non-ATPase 6, transcript variant 2
Clone name	ha00588
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1308 bp) Predicted protein sequence (397 aa)
HaloTag ORF Clone	FHC01960
Flexi ORF Clone	FXC01960
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0107 by Kazusa Mouse cDNA Project

Length: 1308 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	113 bp
Genome contig ID	gi89161205r_63871271
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCAGCTGTATAAAATAAATACTGCATTGTTGTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTCCATTTATTTTTTTCTTAAACACATAGGCCTTCTAGAATCGGGTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	63971271	63984160	8	99.9	Perfect prediction

Length: 397 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE87141	1.1e-158	99.7	unnamed protein...	Macaca fascicularis
Q3T0B2	2.3e-157	98.5	26S proteasome ...	Bos taurus
XP_541816	3.5e-156	97.7	similar to 26S ...	Canis lupus fam...
AAH59159	4.1e-156	97.9	Proteasome (pro...	Rattus norvegicus
BAB26823	8.5e-155	97.2	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	262	366	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	298	381	SM00088	Proteasome component region PCI

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACAGTCTTCCAGCAGTTCGGC
Primer_r	CGATAATGAGGGGCAAAAAGC
PCR product length	127 (1.7k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles