Order Kazusa clone(s) from : ![]() |
Product ID | ORK00018 |
---|---|
Accession No | D63475 |
Description | adaptor-related protein complex 2, mu 1 subunit, transcript variant 1 |
Clone name | ha01466 |
Vector information | |
cDNA sequence | DNA sequence (1868 bp) Predicted protein sequence (438 aa) |
Flexi ORF Clone | FXC00018 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0109
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 474 bp |
---|---|
Genome contig ID | gi89161205f_185275399 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (109175 - 109224) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 185375399 | 185384572 | 11 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001392 | 15 | 35 | PR00314 | Clathrin adaptor |
IPR001392 | 101 | 128 | PR00314 | Clathrin adaptor | |
IPR001392 | 164 | 192 | PR00314 | Clathrin adaptor | |
IPR001392 | 246 | 273 | PR00314 | Clathrin adaptor | |
IPR001392 | 315 | 330 | PR00314 | Clathrin adaptor | |
IPR001392 | 355 | 366 | PR00314 | Clathrin adaptor | |
HMMPfam | IPR008968 | 162 | 438 | PF00928 | Clathrin adaptor |
ProfileScan | IPR008968 | 170 | 438 | PS51072 | Clathrin adaptor |
ScanRegExp | IPR001392 | 162 | 182 | PS00990 | Clathrin adaptor |
IPR001392 | 266 | 280 | PS00991 | Clathrin adaptor |
Panel name | Genebridge 4 |
---|---|
Primer_f | TGCTTTGCTGCCTTCCCTTTG |
Primer_r | ACAGACAGGTGGATGGGAGAG |
PCR product length | 138 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |