Gene/Protein Characteristic Table for KIAA0123
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07716
Accession No D50913
Description peptidase (mitochondrial processing) alpha, transcript variant 1
Clone name ha01523s1
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (2083 bp)
Predicted protein sequence (528 aa)
Flexi ORF Clone FXC07716
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0123 by Kazusa Mouse cDNA Project
Note We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 2083 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 496 bp
Genome contig ID gi89161216f_138324933
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGCTTCCCTGGTAATAAAGAGCTGGCATCTTTCTT
Flanking genome sequence
(113102 - 113151)
----+----*----+----*----+----*----+----*----+----*
AGCACGGTGTTTTCCTTCTCGCCTGGGGAGGGGCGGTTCTTAAGGGCTGT
Features of the protein sequence
Description

Length: 528 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH33103 0 100.0 PMPCA protein [...
Homo sapiens
Q10713 0 100.0 Mitochondrial-p...
Homo sapiens
AAH22949 0 99.8 PMPCA protein [...
Homo sapiens
Q5R513 0 98.7 Mitochondrial-p...
Pongo abelii
CAH93153 0 98.7 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011765 80 230 PF00675 Peptidase M16
IPR007863 235 434 PF05193 Peptidase M16
ScanRegExp IPR001431 100 123 PS00143 Peptidase M16
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name Stanford G3
Primer_f TTCCCGTGCGTGTTAGTTTGG
Primer_r TTCACCTGCTTCCTGGCTTGC
PCR product length 279 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp