Order Kazusa clone(s) from : ![]() |
Product ID | ORK00023 |
---|---|
Accession No | D50918 |
Description | septin 6, transcript variant I |
Clone name | ha03961 |
Vector information | |
cDNA sequence | DNA sequence (4612 bp) Predicted protein sequence (424 aa) |
HaloTag ORF Clone |
FHC00023
![]() |
Flexi ORF Clone | FXC00023 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0128
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3335 bp |
---|---|
Genome contig ID | gi89161218r_118534939 |
PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (258722 - 258673) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | CCTTAACCCAATGACCCAGTG |
Primer_r | CTACAGTGAGAAAAGCTACCC |
PCR product length | 194 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |