KIAA0134

Product ID	ORK04769
Accession No	D50924
Description	DEAH (Asp-Glu-Ala-His) box polypeptide 34
Clone name	ha04001
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4345 bp) Predicted protein sequence (587 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0134 by Kazusa Mouse cDNA Project

Length: 4345 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2328 bp
Genome contig ID	gi42406306f_52447850
PolyA signal sequence (None)	+--------+--------+----*----+---- CCTGGTTGACAGAGCAAGACTCCGTCTCAAAAAAG
Flanking genome sequence (133868 - 133917)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAAACCCGTCTCTACTAAAAATACAAAATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	52547850	52581716	13	99.0	Terminal No-hit

Length: 587 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14147	0	100.0	Probable ATP-de...	Homo sapiens
EAW57473	0	99.7	DEAH (Asp-Glu-A...	Homo sapiens
EAW57477	8.8e-151	77.2	DEAH (Asp-Glu-A...	Homo sapiens
BAG65475	3e-136	100.0	unnamed protein...	Homo sapiens
EAW57474	4.6e-136	86.5	DEAH (Asp-Glu-A...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011149	1.8e-28	31.9	KIAA0577
AB040921	2.4e-27	31.9	KIAA1488
D86977	6.3e-25	36.5	KIAA0224
AB020697	5.2e-21	30.6	KIAA0890
AB040950	6.7e-19	28.8	KIAA1517

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001650	358	422	PF00271	DNA/RNA helicase
HMMPfam	IPR007502	482	546	PF04408	Helicase-associated region
HMMSmart	IPR014001	159	352	SM00487	DEAD-like helicases
HMMSmart	IPR001650	300	422	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	183	343	PS51192	Helicase
ProfileScan	IPR001650	280	462	PS51194	DNA/RNA helicase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGCAGGTGGGGAATGGATGAG
Primer_r	CCAGTCCCATTTCTCCAAGGC
PCR product length	162 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles