Order Kazusa clone(s) from : ![]() |
Product ID | ORK04769 |
---|---|
Accession No | D50924 |
Description | DEAH (Asp-Glu-Ala-His) box polypeptide 34 |
Clone name | ha04001 |
Vector information | |
cDNA sequence | DNA sequence (4345 bp) Predicted protein sequence (587 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0134
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 2328 bp |
---|---|
Genome contig ID | gi42406306f_52447850 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (133868 - 133917) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 52547850 | 52581716 | 13 | 99.0 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001650 | 358 | 422 | PF00271 | DNA/RNA helicase |
IPR007502 | 482 | 546 | PF04408 | Helicase-associated region | |
HMMSmart | IPR014001 | 159 | 352 | SM00487 | DEAD-like helicases |
IPR001650 | 300 | 422 | SM00490 | DNA/RNA helicase | |
ProfileScan | IPR014021 | 183 | 343 | PS51192 | Helicase |
IPR001650 | 280 | 462 | PS51194 | DNA/RNA helicase |
Panel name | Stanford G3 |
---|---|
Primer_f | TGCAGGTGGGGAATGGATGAG |
Primer_r | CCAGTCCCATTTCTCCAAGGC |
PCR product length | 162 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |