KIAA0144

Product ID	ORK00028
Accession No	D63478
Description	ubiquitin associated protein 2-like, transcript variant 2
Clone name	ha03843
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3411 bp) Predicted protein sequence (983 aa)
HaloTag ORF Clone	FHC00028
Flexi ORF Clone	FXC00028
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0144 by Kazusa Mouse cDNA Project

Length: 3411 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	353 bp
Genome contig ID	gi89161185f_152359279
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AGTCTTCAATAAACTGTGGTATTTCTTTAGCTAAC
Flanking genome sequence (143328 - 143377)	----+--------+--------+--------+--------+----* TCTGGCGTTCTTTCCGTGCATGTCTTTGTGGACACTAGGAACCAATGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	152459279	152502605	25	100.0	Perfect prediction

Length: 983 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001113998	99.9	ubiquitin assoc...	Macaca mulatta
AAI48080	98.7	UBAP2L protein ...	Bos taurus
ABM06060	98.7	ubiquitin assoc...	Bos taurus
BAG64560	99.1	unnamed protein...	Homo sapiens
EDL15170	98.1	ubiquitin assoc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040924	9e-26	47.1	KIAA1491

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000449	49	89	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR000449	50	88	SM00165	Ubiquitin-associated/Translation elongation factor EF1B
ProfileScan	IPR000449	49	89	PS50030	Ubiquitin-associated/Translation elongation factor EF1B

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTTAAACTCCCACCTACTCC
Primer_r	TGAGGTTGTTCCCAGTTTCCC
PCR product length	147 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles