KIAA1491

Product ID	ORK07262
Accession No	AB040924
Description	ubiquitin associated protein 2
Clone name	fj08187
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2920 bp) Predicted protein sequence (757 aa)
Source	Human fetal brain
Rouge ID	mKIAA1491 by Kazusa Mouse cDNA Project

Length: 2920 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	645 bp
Genome contig ID	gi89161216r_33811857
PolyA signal sequence (None)	+--------+--------+----*----+---- GTCCCTAGAGACTTACTAGAGACTGGCTGACCATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATAATCTGAGTTATTCAGCCAGTCAGCTCCCCTTTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	33911857	33938556	17	99.9	Perfect prediction

Length: 757 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW58476	99.9	hCG1811260, iso...	Homo sapiens
EAW58475	99.9	hCG1811260, iso...	Homo sapiens
Q5T6F2	99.9	Ubiquitin-assoc...	Homo sapiens
BAG63966	99.9	unnamed protein...	Homo sapiens
BAG64527	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63478	1.5e-27	47.1	KIAA0144

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AATCACGACTTGTCTCACTCC
Primer_r	CATACTTGGGTGGAGGGATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-