KIAA0153

Product ID	ORK00432
Accession No	D63487
Description	tubulin tyrosine ligase-like family member 12
Clone name	ha00521
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3394 bp) Predicted protein sequence (638 aa)
HaloTag ORF Clone	FHC00432
Flexi ORF Clone	FXC00432
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0153 by Kazusa Mouse cDNA Project

Length: 3394 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1475 bp
Genome contig ID	gi89161203r_41792573
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CTCAGTTCGTGCTGCAATAAAGGCCATCTTCTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTGCCCTCCTTTCTCTTTGGACCCTGGAGCCACAGGCTCAGCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	41892573	41913003	15	99.7	Internal No-hit

Length: 638 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14166	100.0	Tubulin--tyrosi...	Homo sapiens
XP_001171890	99.1	tubulin tyrosin...	Pan troglodytes
CAQ09718	100.0	tubulin tyrosin...	Homo sapiens
XP_001104848	97.5	similar to CG15...	Macaca mulatta
XP_515178	99.2	tubulin tyrosin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D79995	0.001	21.6	KIAA0173

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	340	636	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	294	638	PS51221	Tubulin-tyrosine ligase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCGCCTTATCACCCATTCCAG
Primer_r	AGATACTGATTTCCCTGTTGG
PCR product length	141 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles